I know that when adults go to get genome sequencing, the doctors are able to tell them about diseases from their family’s past and if they are likely to get them by looking at their DNA.
But is giving birth to a premature baby considered a disease that can get passed down?
Comments:
No
What is the probability that you would find the sequence: acgcagtcgctgcatttatt in another part of a bacterial genome? The sequence is complementary to the last 20 bases in a single strand of copR gene.
Thanks in advance.
Comments:
You did not provide enough information to do the calculation … how many base pairs are there in the bacterial genome?
The probability of getting the exact 20-nucleotide sequence specified, by chance linking together of nucleotides from a pool containing an ‘infinite’ number of each of the 4 nucleotides, with the pool being thoroughly mixed,and given only a single shot, is 1 in 4^20 or about 1 in a trillion.
The Neanderthal genome sequencing done by geneticists and published last month revealed that the two groups interbred to a limited degree. This would seem to help account for the differences in skin color, eye color and hair texture between the different human races.
Comments:
That is a retarded supposition. Neanderthals and modern humans only interacted in western Europe. Races as we know them were shaped by long term geographic influence. Anyone who has taken Anthro-101 could tell you that.
For instance: The people of the Andes mountains are short and barrel chested– Because they live in high altitude their bodies are built to absorb low Oxygen.
Mid-easterners are dark skinned– People who live in warm areas with lots of light need to reflect more of the sun to stay cool
this may seem as an odd question…but would you rather pay 0k for a spaceflight or 00 for DNA sequencing of your genome? 10x.
Additional Details
Additional details: genome sequencing is used to predict some diseases or determine your heredity.
Comments:
Could it be your goal to find occupation with offshore marine contractors? It won’t definitely raise eye brows in case your answer is certainly. It’s common knowledge that people who actually work on overseas sites, as well as pipeline layers, electricians and oil riggers, get compensated top dollar for his or her employment. Their salaries tend to be simply just as competing as those office workers obtain for the average, possibly even far more. It’s not unheard of for workers within overseas jobsites to post incomes amounting to $60,000 or even $70,000 each year.
Sadly, it’s getting difficult to get offshore jobs mainly because firms that provide them with are getting pickier. It’s really not a shock to learn that. A great number of personages tend to be paying near focus from what off shore marine contractors perform, using one of these are generally civic and ecological supporters, people in politics, and in many cases legal professionals wanting to find compensation for his or her clients who were past workers that experienced job-related injuries. One miscalculation, made by perhaps the lowliest connected with workers in the work place, can produce a catastrophe to the employing business because the business could lose contracts, get massive money complications, and in many cases produce a situation with all the media.
Getting engaged with offshore construction will require that you must be at your peak physical and mental status. It is no secret that a few of the things you could undertake include carrying out work in unsafe conditions, being apart from your family for many months, having sporadic resting time, and dwelling in a location with limited room and resources. As you can see, doing work in the midst of the sea isn’t completely a piece of cake – peril will always be right beside you.
If earning a living for offshore marine contractors is one area you eagerly want, you’ll have to plan in advance for the position. The inference is you need to go beyond just having the required expertise. It’s a must for you to display your potential businesses which you’re the main one they demand. The skills you’ve had to have to make companies prefer to employ you, what exactly are they? First, you must have trained appropriately in your kind of work and attained sufficient hands-on experience correctly. As one example of, if you are looking to land the engineering position inside a pipeline construction project, you have to have an engineering diploma and license and several prior expertise working for an engineering firm.
It would be invaluable for your needs also if you realize the safety guidelines and procedures workers observe on the job. Always keep in mind the fact that overseas job might be challenging and risky. One modest slip-up can impact not only for this company you work intended for, but also your co-workers, the environment and also the general community. Do you need to possibly be instructed that you must know how to swim to work overseas? It won’t damage to turn into a qualified diver, perhaps.
Demonstrating the fact that you’ve gained the accreditations for the employment you’d like can certainly make it easy to be able to acquire that employment. The great thing about it is once you piled up additional experience with the distinctive line of job, you’ll recuperate possibilities for the purpose of better pay off. However, you will need to consider that you must sacrifice a number of the conveniences so that you can generate that kind of income. You’d be required to stay at sea for long periods of time. You’d probably have 12-hour workdays. You’d do not have solitude by any means, and you’d dwell among unknown people. Exactly what you ought to surrender may bombard you initially. Though soon you won’t care about most of these difficulties any longer, especially when you finally start making the most of your work with offshore marine contractors.
a. The genome of a mouse has been sequenced.
b. The genomes of about 500 species have been completely or almost completely sequenced.
c. Most of the genomes that have been sequenced to date are eukaryotes.
d The first multicellular organism to have its genome sequenced was a nematode.
e. The first eukaryotic organism to have its genome sequenced was yeast.
Comments:
I believe (c) is false.